Seudónimo Seudónimo
  • 01-03-2022
  • Mathematics
contestada

Can you please help me

Can you please help me class=

Respuesta :

whi622386 whi622386
  • 01-03-2022

Answer:

-17 (I believe)

Step-by-step explanation:

If x = 64 then the first one is asking for the square root of 64 (8)

With y being 25 the second part of this problem is actually really easy, all its doing is getting the square root and then squaring it (doing nothing at all) so that would just be 25 which would make it

8-25 which would be -17

Answer Link

Otras preguntas

What is the allele number for the following sequence? (3pts) GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA
Blood has a lower concentration of hydrogen ions than cellular cytoplasm. What does that tell us about the pH?
What is essential to strong evaluation, according to Charles Taylor?
Plz help I am timed What is the rule for this pattern? 7, 10, 5, 8, 3, 6, 1 A.start with 7 and add 3 repeatedly B.start with 7 and subtract 5 repeatedly C.star
Inequality to Verbal -3 < x < 7 A. The domain is greater than or equal to -3 and less than or equal to 7. B. The range is greater than -3 and less than 7.
How to solve 25= 4+ 7x
Also the explanation:)
Using a force of 10 N, you push a shopping cart 10 m. How much work did you do?
HELP! Because of the rising civil rights movement in the 1950s and 1960s, the Vietnam War (1955-1975) was the first war in which Deaf people were NOT allowed to
In which of the following relationships do both species benefit? A. Competition B.Commensalism C. Parasitism D. Mutualism