miguelpoblano8684 miguelpoblano8684

02-05-2022
Spanish

contestada

Fill in the appropriate verb forms: present subjunctive or infinitive.

Les gusta que esa fábrica le____________muchas oportunidades a la comunidad. (ofrecer)

Respuesta :

heydeetrevino heydeetrevino

02-05-2022

The correct answer should be Ofrezca

Answer Link

rn7z2kng6n rn7z2kng6n

02-05-2022

La respuesta debería de ser ofrezca

Answer Link

Otras preguntas

Which statements are true about Greenland? Greenland's borders are the Pacific and Arctic Oceans.Greenland's borders are the Arctic and Atlantic Oceans.Greenlan

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

Why do the cells in all living things need energy? A. to fuel their chemical reactions B. to help them decompose C. to communicate with other cells D. so th

how would i solve these?

how are siamese twins formed

Please help me . factor. 4x^2+26x+30

1. Who suggested that the molecular formula for water is H2O, not OH? A. Torricelli B. Lewis C. Pascal D. Dalton E. Avogadro F. Boyle G. Charles

10/n = 18/27 what is n?

What did Americans value during the Enlightenment? how did these values shape their american dream?

Which of these quadrilaterals is never a parallelogram? A) Kite B) Rectangle C) Rhombus D) Square (5 Points)