emileeyss3 emileeyss3
  • 11-05-2022
  • Mathematics
contestada

Let f(x) = -4x + 7 and g(x) = 2x - 6.
Find (fºg)(1).

A 23
B 0
C 3
D -4

Let fx 4x 7 and gx 2x 6 Find fºg1 A 23 B 0 C 3 D 4 class=

Respuesta :

jeremiahshoniwa7
jeremiahshoniwa7 jeremiahshoniwa7
  • 16-05-2022

Answer:

I will get the function of g (x) and plug it on X in the function of f ( x ) and then later substitute X with 1

Answer Link

Otras preguntas

How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Which sentence does not contain any errors in comma usage? A. If you ever visit New Haven, Connecticut, be sure to eat at Sally's Pizza. B. The original Londo
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
a antonym for biosphere
How to change 3 7/8 into an improper fraction
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
Companies raise funds to expand their business by
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5