cxbrat cxbrat
  • 12-05-2022
  • Mathematics
contestada

What's 8.88=4.444(x-7)

Respuesta :

Devinlepoer07
Devinlepoer07 Devinlepoer07
  • 12-05-2022

Answer:

i think its 9

Step-by-step explanation:

8.88=4.444x-31.108

39.988=4.444x

x=8.998

Answer Link
Аноним Аноним
  • 12-05-2022

Answer:

x = 9

Step-by-step explanation:

Given

  • 8.88 = 4.44 (x - 7)

Divide both sides by 4.44

  • 8.88/4.44 = 4.44/4.44 (x - 7)
  • 2 = x - 7

Add 7 to each side.

  • x - 7 + 7 = 2 + 7
  • x = 9
Answer Link

Otras preguntas

Would someone please help me with my french? Thank you!
Identify which equation is a graph of a vertical line? 4x = y, x = 4 , y = 4, x = 4y
Torri had $20 to buy a birthday present for her dad. She decided to buy a DVD for 18$. The sales tax is 7%. Does she have enough money?
Please help IMG_1984.HEIC
Carl ran 27 miles last week. This is 3 times farther than Anna ran. Which equation can be used to find how many miles Anna ran?
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
What are the inferior goods?
what decision did the allies make about the future of Germany at the Yalta conference
do you believe that most violent juvenile offenders can be rehabilitated? explain
Hamlet a character is complex in the excerpt because