428257 428257
  • 03-06-2022
  • Mathematics
contestada

the avrge amount of rainfalls is?

Respuesta :

ashleyv202236
ashleyv202236 ashleyv202236
  • 03-06-2022

Answer:

For the entire United States, excluding Hawaii and Alaska, the average amount of moisture falling as rain and snow is 30.21 inches

Step-by-step explanation:

depends on the state

Answer Link

Otras preguntas

What was the overall goal of richard nixon's southern strategy? answers?
The throne was inherited in which kingdom
Wich statement about the following equation is true ? 3x^2-8x+5=5x^2
Psychologists regard _______________ as the "fear of fear."
Person can have several spouses in his or her lifetime but only one spouse at a time is called:
Al + h2so4 → al2(so4)3 + h2 when the equation is correctly balanced, the coefficient of h2so4 is -
A confined aquifer is _____. found in the unsaturated zone found between two impermeable layers the top layer of the saturated zone separated from the main grou
Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds
Choose the correct simplification of the expression (−21r9s3t36)0
A Lesson Before Dying Essay Help I don't want someone to right it for me i just need help getting started. Topic question: Jefferson and Grant must both take a