thatonechild thatonechild

15-07-2022
Biology

contestada

What is the replicated DNA sequence for GGC GAG AAT GAA ACT ATT TGT AGC

Respuesta :

ariahuds8154 ariahuds8154

15-07-2022

Answer:

ccgctcttactttgataaacatcg

Answer Link

Otras preguntas

f(x)= 2lxl? (graphing absolute values) I'm a little confused.

what is the fraction of 24/16 simplest form

In August, the Simons water bill was $48. In September, it was15% lower. What was the Simons water bill in Septemper? I don't get it because I got 7.2. Please h

where are mountains usually found?

Bananas are $0.59/pounds. What is the constant of proportionality?

What is the Hcf of 25 and 125

How much higher is Checkpoint 5 than Checkpoint 2? Checkpoint 5 is -52Checkpoint 2 is -196

Use the Associative and Commutative Properties to make this calculation easier. Justify the steps. 6•(17•50)

What type(s) of symmetry does this figure have?

For a chemical reaction it is usually found that the reaction rate is faster at higher temperature. The rate increases because (a) the concentrations of reacta