breanna4921 breanna4921
  • 15-12-2022
  • Chemistry
contestada

Why is air resistance important?

Respuesta :

1315064008
1315064008 1315064008
  • 15-12-2022

Answer:

air resistance affects the movement of the falling object by slowing it down.

Explanation:

Answer Link

Otras preguntas

Dear Principal Fallows, (1) I am concerned about the school board’s decision to make every senior participate in 40 hours of community service in order to gradu
“The liberties of a people never were, nor ever will be ,secure, when the transactions of their rulers may be concealed from them.”
Which of the following best describes the proper use of a "Works Cited" page? A. A "Works Cited" page is not needed if you paraphrase your research.
can u answer this pls
Gaseous C2H4 reacts with O2 according to the following equation: C2H4 (g) + 302 -> 2CO2 + H2O (g) What volume of oxygen gas at STP is needed to react with 5.
4. Barry wants to make a drawing that is 1/4 the size of the original. If the tree in the original drawing is 14 inches tall, how tall will the tree be in Barry
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
Work out 162 x 43 without using a calculator
Find the interest due on $950 at 13% for 120 days.
Check all that apply. Claims must always be supported by evidence such as facts. opinions. statistics. quotations. examples. hypotheticals.