d5aNickennKdo d5aNickennKdo
  • 15-03-2017
  • Physics
contestada

Obstacles in a river best represent _________ in an electric circuit.
a. low voltage
b. high voltage
c. amperage
d. resistance

Respuesta :

Аноним Аноним
  • 25-03-2017
D.) Obstacles in a river best represent "Resistance" in an Electric Circuit.

Hope this helps!
Answer Link
Аноним Аноним
  • 25-03-2017
resistance will be the answer.. it's unit is ohm..

Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the most common type of vegetation throughout Latin America
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
A shelf at a bookstore displays 27 books. Of these 27 books, 9 of the books are nonfiction books. The store owner adds 6 new fiction books to the shelf and want
Susan ........ (Run) to school because she was late.
What was George Washington's nickname?
Failure to incorporate _______ can easily lead to _______. Would the answer be: citations, plagiarism?
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Is 5/7 greater than 4/6
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.