lindseydemark
lindseydemark lindseydemark
  • 01-05-2017
  • Mathematics
contestada

A swimmer swam 0.8 mi at 0.0323 mi per min in waters created by melted sea ice. What was his​ time?

Respuesta :

HomertheGenius
HomertheGenius HomertheGenius
  • 08-05-2017
We have to calculate the time of a swimmer. He swam 0.8 miles at 0.0323 miles per minute.
Formula for time:
t = d / v , where d stays for the distance and v stays for velocity.
t = 0.8 mi/ 0.0323 mi per min. = 24.77 minutes
Answer:
His time was 24.77 minutes.
Answer Link

Otras preguntas

Helena has five different flowers. She plans to give one flower to each of her five teachers in any order. She gives the first flower to one of her teachers in
How did new industrial technologies influence the course of world war i?
Which state ratified the constitution after congress agreed to amend the constitution to include the bill of rights
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1
Describe these small intestine structures and their functions: intestinal glands -
The actions of the pueblo indians at santa fe in 1680 can best be described as:
Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254
need help anybody know how to do this
A number is increased by 50 percent, then the resulting number is decreased by 40 percent. What is the original number if the final number is eight less than th