dacodapope1 dacodapope1

15-06-2017
History

contestada

Which of the following statements best summarizes the relationship between farming and the growth of towns?

Respuesta :

shamssbh shamssbh

15-06-2017

Without farming the town would not be able to grow because it provides plants, crops and also meat and other dairies

Answer Link

Otras preguntas

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Which systems advocates that the suffering of the worker should be made lighter through intervention by the government?

Select the correct forms of ser/estar throughout the paragraph: hola ({1}soy, estoy) Pablo tengo años. ¿Cómo ({2}están, eres) hoy? Yo ({3}estoy, soy) muy bien

An electron travels north at a velocity of 3.0 × 107 m⁄s into a magnetic field of 0.070 T pointing exactly southeast. An electron has a negative charge of 1.6 ×

EXTREME QUESTION Why aren't blueberries blue?

which group found the volume of a triangular pyramid with a height of 18 inches

A recent study reported that 18- to 24-year-olds average 192 restaurant visits per year. Assume that the standard deviation for number of visits per year for th

Is coronavirus a cell? Explain. (40 points, but you get 20)

A chef is going to use a mixture of two brands of Italian dressing. The first brand contains 7 vinegar, and the second brand contains 12 vinegar. The chef wants

Pure magnesium metal is often found as ribbons and can easily burn in the presence of oxygen. When 3.97 g of magnesium ribbon burns with 8.05 g of oxygen, a bri