Kermon5660 Kermon5660

03-07-2017
Biology

contestada

A microbes that grows best in a low-oxygen environment is called a(n):

Respuesta :

pvskota pvskota

08-07-2017

A Microaerophile is a microbe that is best suited to growing in a low-oxygen environment.

Answer Link

Otras preguntas

How many terms are in the expression shown below? x^2 - 10xy + 3y + y^2 - 1 2 3 4 5

Buyers have increased their use of direct and digital marketing because they are __________.

Who made gravity to make earth.

If survey questions are standardized and close-ended, they can produce data that is statistically comparable. a. True b. False

a line segment that has 1 endpoint at the center of the circle and the other endpoint on the circle

A ___________ is a consumer problem, need, or desire that a business could provide a solution for. A. Change or trend B. Company goal C. Business opportunity D.

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

please help me with this question, thank you!

The parietal layer of the serous pericardium __________. the parietal layer of the serous pericardium __________. normally contains blood lies between the parie

The coordinates of A,B,C are given below. What are the coordinates of A’, B’ and C’ after a reflection across the x-axis? A(-4, -1) B(-2,