micaelasmith32
micaelasmith32 micaelasmith32
  • 04-03-2019
  • Mathematics
contestada

Help asap Find the value of x in the triangle
A.2
B.29
C.63
D.299



​

Help asap Find the value of x in the triangle A2B29C63D299 class=

Respuesta :

wegnerkolmp2741o
wegnerkolmp2741o wegnerkolmp2741o
  • 04-03-2019

Answer:

x = 29

Step-by-step explanation:

The three angles of a triangle add to 180

x+90+61 = 180

Combine like terms

x+151 = 180

Subtract 151 from each side

x+151-151 = 180-151

x = 29

Answer Link
Alliskia
Alliskia Alliskia
  • 04-03-2019
The answer is B.29.
Answer Link

Otras preguntas

The artwork above shows which element best
what is the origin of aluminium
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
-(12/5a-7x+31/6b)-3x+3a b
Write Inequalities to Describe Domain and Range Use the drop downs to determine which symbols would complete the inequality for the domain. −4 ___(a)___ x ___(b
Calculate the difference and enter below. 3-9
As a result of the Smoot-Hawley Tariff,
El país de Colombia es muy peligroso y no debes visitarlo. Hay muchas maravillas del mundo en todas partes del país. No puedes encontrar muchas joyas en la na
describe any four functions of bank​
any 1 can be my friend​