dsumnicht dsumnicht
  • 12-05-2016
  • History
contestada

The Code of Hammurabi was written by the king of _____.

Sumer
Babylonia
Nubia
Assyria

Respuesta :

Аноним Аноним
  • 12-05-2016
B, Babylonia, because it was written by King Hammurabi himself, and he ruled Babylonia.
I took World History last year, so you could trust me with this ;-)
I hope I helped! =D
Answer Link
Jbare1111
Jbare1111 Jbare1111
  • 03-11-2021

Answer:

it should be bavylonia

Explanation:

Answer Link

Otras preguntas

Personification or Hyperbole. The bear used a trunk of the tree to give himself a manicure
Whats your thoughts about genetically modified crops
What does (h,k) standard for in the standard circle equation?
The _is most likely to be in charge of balancing the cash box before closing the office at the end of the day. nurse medical technician physician receptionist
what is the measure of x?
Help with number 5 please
30.5 mm 112 mm 18 mm 10 mm
We have no quarrel with the German people. We have no feeling towards them but one of sympathy and friendship. It was not upon their impulse that their Governme
HBr + KOH —> KBr + H2O
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG