Pleasehelp124 Pleasehelp124

03-02-2022
Mathematics

contestada

solve algebraically using substitution or elmantion your choise -2x + 6y = -10 y = -4

Respuesta :

dissonanceruckus dissonanceruckus

03-02-2022

Answer:

x = -7

Step-by-step explanation:

Ver imagen dissonanceruckus

Answer Link

Otras preguntas

explain the identufication and nomeclature

For the three landmark court cases we covered in this unit, John Marshall was the Chief Justice of the Supreme Court. His decisions...* 1.Were generally accepte

Factorise x² - x with explanation please?

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

ok I really need help I need the right answer pleasee and ill give brainliest. but if u just want the points please don't submit a wrong answer just comment on

What is the constant of proportionality for the relationship shown in the table? x 2 4 6 8 y 1 2 3 4 1/2 2 or not proportional

A student incorrectly solved an exponential equation looking at the work shown, what mistake did the student make

this is not a test btw just a worksheet I’m stuck on

How do you solve Y=2x+2 Y=0

Britanny spent more than $42 at the mall. She bought a shirt for $14 and 4 sweaters that cost the same amount. Find the graph that shows the possible cost, s of