zurisadaihuerta11 zurisadaihuerta11

02-05-2022
Mathematics

contestada

Sally uses the pattern rule y = 4 + b to generate the first three outputs in the pattern. Which of the following is the fifth output in the pattern?
Captionless Image
5
9
8
10

Respuesta :

Аноним Аноним

02-05-2022

Answer:

9

Step-by-step explanation:

y = 4 + b

Output is y

Input is b

We are asked to find out what we get if we input 5.

y = 4 + 5

4 + 5 = 9

y = 9

9 is the fifth output

Answer Link

Otras preguntas

Without using a graphing utility, find all the roots of the following polynomials. You may use whatever techniques you want to. There are many different approac

The quotient of a number and 5 plus 25 is no more than 45. What are the possible values for the number?

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

Where do I find motor tracks in the spine? (Posterior or Anterior)?

9 tens 9 ones 7 tenths 7 hundredths

54 A device for impact testing consists of a 34-kg pendu- lum with mass center at G and with radius of gyration about 0 of 620 mm. The distance b for the pendul

are there any vaccines?

Mis padres no _____ chaqueta. llevan lleva llevamos

Calcium Oxide, CaO 1. How many formula units (particle) in 1 mole CaO? 2. What is the mass of 1 mole CaO?

The question is "What does the y-intercept of the line of best fit tell you about the situation below?"